معلومة

ما هو الكائن الحي الذي لديه أطول حد من Hayflick؟

ما هو الكائن الحي الذي لديه أطول حد من Hayflick؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

بافتراض أنني أفهم المفهوم بشكل صحيح ، فإن حدود Hayflick تعكس قدرة الخلايا على الانقسام المستقر. بالإضافة إلى ذلك ، تختلف حدود Hayflick للكائنات الحية المختلفة.

سؤالي هو ، ما هو الكائن الحي الذي لديه أطول حد من Hayflick؟ أعلم أن البشر لديهم واحد يتراوح بين 40-60 ، فقط لإعطاء سياق بسيط.


يرتبط حد Hayflick عمومًا بطول التيلومير. التيلوميرات البشرية طويلة إلى حد ما مع تقدم الأنواع ، لكنها ليست استثنائية. العديد من أنواع الفئران ، والقوارض الأخرى ، لديها تيلوميرات أطول بكثير من البشر ، على سبيل المثال ، ومن الواضح أن لها عمرًا أقصر بكثير. هناك أيضًا شيء مثل "التيلومير الضخم" ، موجود في عدد من أنواع الطيور ، والتي يمكن أن تكون أطول بمئات المرات من التيلوميرات البشرية.

لا يوجد سوى علاقة غامضة بين طول التيلومير وعمر الأنواع. انظر البيولوجيا المقارنة لتيلوميرات الثدييات: فرضيات عن حالات الأجداد وأدوار التيلوميرات في تحديد طول العمر لنقطة البداية. التيلوميرات جزء من قصة طول العمر ، لكنها على الأرجح جزء صغير إلى حد ما.

ومع ذلك ، لا أرى تصريحًا صريحًا بأن تلك الأنواع ذات التيلوميرات الطويلة جدًا لديها حد أعلى من Hayflick. أفترض أن هذا لأن حد Hayflick هو وصف شديد التبسيط وليس وصفًا مفيدًا للغاية لمجموعة محددة جدًا من الشروط ، لكنني لا أعرف ذلك بالتأكيد.


موثوقية ضوابط الانتشار. حد Hayflick وانهياره في السرطان

تقدم هذه الورقة نظرية جديدة للحد من Hayflick ودورها في السرطان. يتم تحديد حد Hayflick كآلية آمنة من الفشل تقصر على الحيوانات المستنسخة من الخلايا ذات الحجم غير المؤذي والتي تتعطل فيها عناصر التحكم في الانتشار الطبيعي. ينشأ الورم الخبيث عندما يتم تعطيل حد Hayflick. يقال إن حد Hayflick يرجع إلى التمايز تجاه حالة عدم الانتشار. يتم تصور الساعات التنموية الزائدة عن الحاجة كآلية. يمكن أن تتداخل المواد الكيميائية المسرطنة والمحفزات مع هذه الساعات. كما أن منتجات الجينات الفيروسية وتكامل الحمض النووي الفيروسي يمكن أن يوقف ساعة النمو ويؤدي إلى تحول خبيث في الخلايا التي عانت بالفعل من طفرات في آلياتها التنظيمية الطبيعية التي تتحكم في الانتشار. يمكن فهم التحول الفيروسي على أنه استراتيجية فيروسية للبقاء والانتقال إلى مضيف جديد. قد تشكل الحيوانات المستنسخة الخبيثة مكانًا مناسبًا للعديد من الفيروسات البطيئة. يشير الأداء الطبيعي لحد Hayflick إلى شيخوخة الأنسجة بسبب التمايز نحو حالة عدم التكاثر. وبالتالي ، قد يكون الحد هو سبب الشيخوخة على الرغم من أنه ليس بسبب تراكم الطفرات الجسدية.


محتويات

في أوائل السبعينيات ، أدرك المنظر الروسي أليكسي أولوفنيكوف لأول مرة أن الكروموسومات لا يمكنها تكرار نهاياتها تمامًا. بناءً على ذلك ، واستيعابًا لفكرة ليونارد هايفليك عن الانقسام المحدود للخلايا الجسدية ، اقترح أولوفنيكوف أن تسلسل الحمض النووي يُفقد في كل مرة تتكاثر فيها الخلية حتى تصل الخسارة إلى مستوى حرج ، وعند هذه النقطة ينتهي انقسام الخلية. [1]

في 1975-1977 ، اكتشفت إليزابيث بلاكبيرن ، وهي تعمل زميلة ما بعد الدكتوراه في جامعة ييل مع جوزيف ج. غال ، الطبيعة غير العادية للتيلوميرات ، بتسلسلات الحمض النووي المتكررة البسيطة التي تتكون منها نهايات الكروموسوم. [2] مُنح بلاكبيرن وكارول جريدر وجاك زوستاك جائزة نوبل عام 2009 في علم وظائف الأعضاء أو الطب لاكتشافهم كيفية حماية الكروموسومات بواسطة التيلوميرات وإنزيم التيلوميراز. [3]

في عام 1983 ، تلقت باربرا مكلينتوك ، عالمة الوراثة الخلوية الأمريكية وأول امرأة تحصل على جائزة نوبل غير المشتركة في علم وظائف الأعضاء أو الطب ، على جائزة نوبل لملاحظتها أن الكروموسومات التي تفتقر إلى الأجزاء النهائية أصبحت "لزجة" وافترضت وجود بنية خاصة في طرف كروموسوم يحافظ على استقرار الكروموسوم. [4]

إنهاء مشكلة النسخ المتماثل تحرير

أثناء تكرار الحمض النووي ، لا يمكن لبوليميراز الحمض النووي تكرار التسلسلات الموجودة في النهايات الثلاثية. هذا هو نتيجة لوضعه أحادي الاتجاه لتخليق الحمض النووي: يمكنه فقط ربط نيوكليوتيدات جديدة بنهاية 3'-end (أي ، يتقدم التوليف 5'-3 ') وبالتالي يتطلب التمهيدي لبدء النسخ المتماثل. على الخيط الرئيسي (الموجه 5'-3 'داخل شوكة النسخ المتماثل) ، يتكاثر DNA-polymerase باستمرار من نقطة البدء على طول الطريق إلى نهاية الشريط مع التمهيدي (المصنوع من RNA) ثم يتم استئصاله واستبداله بواسطة DNA. ومع ذلك ، فإن الخيط المتأخر موجه إلى 3'-5 'فيما يتعلق بشوكة النسخ ، لذا فإن التكرار المستمر بواسطة DNA-polymerase أمر مستحيل ، مما يتطلب تكرارًا متقطعًا يتضمن التوليف المتكرر للاشعال 5' من موقع البدء (انظر التأخير تكرار حبلا). يقع التمهيدي الأخير الذي يتم مشاركته في النسخ المتماثل المتأخر بالقرب من نهاية 3'- نهاية القالب (المقابلة للنهاية المحتملة 5'من الشريط المتأخر). في الأصل كان يعتقد أن التمهيدي الأخير سيجلس في نهاية القالب ، وبالتالي ، بمجرد إزالته ، فإن بوليميريز الحمض النووي الذي يستبدل البادئات بالحمض النووي (DNA-Pol في حقيقيات النوى) [الملاحظة 1] لن يكون قادرًا على توليف "استبدال الحمض النووي" من الطرف 5'من الخيط المتأخر بحيث لا يمكن تكرار نيوكليوتيدات القالب التي تم إقرانها سابقًا مع آخر تمهيدي. [5] وقد تم التساؤل منذ ذلك الحين عما إذا كان آخر خيط تمهيدي متخلف قد تم وضعه بالضبط في الطرف الثالث من القالب ، وقد تم إثبات أنه تم تصنيعه إلى حد ما على مسافة حوالي 70-100 نيوكليوتيد وهو ما يتوافق مع النتائج. يتم تقصير الحمض النووي في الخلايا البشرية المستزرعة بمقدار 50-100 زوج قاعدي لكل انقسام خلية. [6]

إذا تم تدهور تسلسل الترميز في هذه العملية ، فسيتم فقد الكود الجيني الحيوي المحتمل. التيلوميرات عبارة عن تسلسلات متكررة غير مشفرة تقع عند نهاية الكروموسومات الخطية لتعمل كمخازن مؤقتة لتلك التسلسلات المشفرة المتأخرة. إنها "تغطي" التسلسلات النهائية وتتحلل تدريجياً في عملية تكرار الحمض النووي.

إن "مشكلة النسخ النهائي" مقصورة على الكروموسومات الخطية حيث أن الكروموسومات الدائرية ليس لها نهايات تقع دون الوصول إلى بوليميراز الحمض النووي. وبالتالي ، فإن معظم بدائيات النوى ، التي تعتمد على الكروموسومات الدائرية ، لا تمتلك التيلوميرات. [7] جزء صغير من الكروموسومات البكتيرية (مثل تلك الموجودة في ستربتوميسيس, أجروباكتريوم، و بوريليا) ، مع ذلك ، خطية وتمتلك تيلوميرات ، والتي تختلف تمامًا عن تلك الموجودة في الكروموسومات حقيقية النواة في التركيب والوظيفة. تأخذ الهياكل المعروفة للتيلوميرات البكتيرية شكل بروتينات مرتبطة بنهايات الكروموسومات الخطية ، أو حلقات دبوس الشعر من الحمض النووي أحادي الجديلة في نهايات الكروموسومات الخطية. [8]

ينتهي التيلومير والمأوى في تحرير

في نهاية 3'-نهاية التيلومير يوجد 300 زوج قاعدي متدلي يمكنه غزو الجزء المزدوج الذي تقطعت به السبل من التيلومير مكونًا بنية تعرف باسم T-loop. تشبه هذه الحلقة العقدة ، التي تعمل على استقرار التيلومير ، وتمنع التعرف على نهايات التيلومير كنقاط توقف بواسطة آلية إصلاح الحمض النووي. في حالة حدوث انضمام طرف غير متماثل عند نهايات التيلومير ، سينتج اندماج الكروموسومات. يتم الحفاظ على الحلقة T بواسطة عدة بروتينات ، يشار إليها مجتمعة باسم مجمع المأوى. في البشر ، يتكون مجمع الملجأ من ستة بروتينات تم تحديدها على أنها TRF1 و TRF2 و TIN2 و POT1 و TPP1 و RAP1. [9] في العديد من الأنواع ، يتم إثراء تكرار التسلسل في الجوانين ، على سبيل المثال TTAGGG في الفقاريات ، [10] والذي يسمح بتكوين G-quadruplexes ، وهو تشكيل خاص للحمض النووي يتضمن الاقتران بقاعدة غير Watson-Crick. هناك أنواع فرعية مختلفة تعتمد على مشاركة الحمض النووي أحادي أو مزدوج السلسلة ، من بين أشياء أخرى. هناك دليل على 3'-overhang في ciliates (التي تمتلك تكرارات تيلومير مماثلة لتلك الموجودة في الفقاريات) لتشكيل G-quadruplexes التي تستوعبها ، بدلاً من T-loop. تمثل G-quadruplexes عقبة أمام الإنزيمات مثل بوليميرات الحمض النووي ، وبالتالي يُعتقد أنها تشارك في تنظيم النسخ والنسخ. [11]

تحرير تيلوميراز

العديد من الكائنات الحية لديها إنزيم يسمى تيلوميراز ، والذي يقوم بمهمة إضافة متواليات النوكليوتيدات المتكررة إلى نهايات الحمض النووي. إن التيلوميراز "يجدد" "غطاء" التيلومير. في معظم الكائنات حقيقية النواة متعددة الخلايا ، يكون التيلوميراز نشطًا فقط في الخلايا الجرثومية وبعض أنواع الخلايا الجذعية مثل الخلايا الجذعية الجنينية وبعض خلايا الدم البيضاء. يمكن إعادة تنشيط التيلوميراز وإعادة التيلوميرات إلى الحالة الجنينية عن طريق نقل نواة الخلية الجسدية. [12] قد يكون للتقصير المستمر للتيلوميرات مع كل تكاثر في خلايا (الجسم) الجسدية دور في الشيخوخة [13] وفي الوقاية من السرطان. [14] [15] هذا لأن التيلوميرات تعمل كنوع من "فتيل" التأخير الزمني ، وينفد في النهاية بعد عدد معين من الانقسامات الخلوية ويؤدي في النهاية إلى فقدان المعلومات الجينية الحيوية من كروموسوم الخلية مع الانقسامات المستقبلية . [16]

طول التحرير

يختلف طول التيلومير اختلافًا كبيرًا بين الأنواع ، من حوالي 300 زوج قاعدي في الخميرة [17] إلى العديد من قواعد الكيل في البشر ، وعادةً ما يتكون من مصفوفات من التكرارات الغنية بالجوانين ، والتي يتراوح طولها بين ستة وثمانية أزواج. تنتهي التيلوميرات حقيقية النواة عادةً بتراكب الحمض النووي أحادي الجديلة بثلاثة أذرع ، وهو أمر ضروري لصيانة التيلومير وتغطيته. تم التعرف على بروتينات متعددة تربط الحمض النووي التيلومير المفرد والمزدوج الشريطة. [18] تعمل هذه الوظائف في كل من صيانة التيلومير والتغطية. تشكل التيلوميرات هياكل حلقة كبيرة تسمى حلقات التيلومير ، أو حلقات T. هنا ، يلتف الحمض النووي أحادي السلسلة في دائرة طويلة ، مستقرًا بواسطة بروتينات ربط التيلومير. [19] في نهاية الحلقة T ، يتم الاحتفاظ بالحمض النووي التيلومير أحادي السلسلة في منطقة من الحمض النووي مزدوج الشريطة بواسطة خيط التيلومير الذي يعطل الحمض النووي الحلزوني المزدوج ، والاقتران الأساسي بأحد هذين الخيطين. يسمى هذا الهيكل الثلاثي الذي تقطعت به السبل حلقة الإزاحة أو حلقة D. [20]

دور في دورة الخلية تحرير

يمكن أن يؤدي تقصير التيلومير في البشر إلى الشيخوخة التكاثرية ، مما يمنع انقسام الخلايا. يبدو أن هذه الآلية تمنع عدم الاستقرار الجيني وتطور السرطان في الخلايا البشرية المسنة عن طريق الحد من عدد الانقسامات الخلوية. ومع ذلك ، فإن التيلوميرات القصيرة تضعف وظيفة المناعة التي قد تزيد أيضًا من قابلية الإصابة بالسرطان. [21] إذا أصبحت التيلوميرات أقصر من اللازم ، فإن لديها القدرة على الانفتاح من بنيتها المغلقة المفترضة. قد تكتشف الخلية هذا عدم التغطية على أنه تلف في الحمض النووي ثم إما أن تتوقف عن النمو ، أو تدخل الشيخوخة الخلوية (الشيخوخة) ، أو تبدأ في التدمير الذاتي للخلية (موت الخلايا المبرمج) اعتمادًا على الخلفية الجينية للخلية (حالة p53). تؤدي التيلوميرات غير المقيدة أيضًا إلى اندماج الكروموسومات. نظرًا لأنه لا يمكن إصلاح هذا الضرر في الخلايا الجسدية الطبيعية ، فقد تدخل الخلية في موت الخلايا المبرمج. ترتبط العديد من الأمراض المرتبطة بالشيخوخة بتقصير التيلوميرات. تتدهور الأعضاء مع موت المزيد والمزيد من خلاياها أو دخولها في الشيخوخة الخلوية.

تحرير الضرر التأكسدي

بصرف النظر عن مشكلة النسخ المتماثل النهائي ، فقد أظهرت الدراسات في المختبر أن التيلوميرات تتراكم الضرر بسبب الإجهاد التأكسدي وأن تلف الحمض النووي الناتج عن الإجهاد التأكسدي له تأثير كبير على تقصير التيلومير في الجسم الحي. هناك العديد من الطرق التي يمكن أن يؤدي بها الإجهاد التأكسدي ، بوساطة أنواع الأكسجين التفاعلية (ROS) ، إلى تلف الحمض النووي ، ومع ذلك ، فمن غير الواضح ما إذا كان المعدل المرتفع في التيلوميرات ناتجًا عن حساسيتها المتأصلة أو انخفاض نشاط الحمض النووي أنظمة الإصلاح في هذه المناطق. [22] على الرغم من الاتفاق الواسع النطاق على النتائج ، فقد تمت الإشارة إلى عيوب واسعة النطاق فيما يتعلق بالقياس وأخذ العينات على سبيل المثال ، يُقال إن الأنواع المشتبه بها واعتماد الأنسجة للأضرار التأكسدية للتيلوميرات لم يتم تفسيرها بشكل كافٍ. [23] أشارت الدراسات السكانية إلى وجود تفاعل بين تناول مضادات الأكسدة وطول التيلومير. في مشروع دراسة سرطان الثدي في لونغ آيلاند (LIBCSP) ، وجد المؤلفون زيادة معتدلة في خطر الإصابة بسرطان الثدي بين النساء ذوات أقصر تيلوميرات وانخفاض في المدخول الغذائي من بيتا كاروتين وفيتامين ج أو هـ. [24] هذه النتائج [25] تشير إلى أن قد تتفاعل مخاطر الإصابة بالسرطان بسبب قصر التيلومير مع آليات أخرى لتلف الحمض النووي ، وخاصة الإجهاد التأكسدي.

الارتباط مع الشيخوخة تحرير

يرتبط تقصير التيلومير بالشيخوخة والوفيات والأمراض المرتبطة بالشيخوخة. ترتبط الشيخوخة الطبيعية بقصر التيلومير في كل من البشر والفئران ، وتشير الدراسات التي أجريت على نماذج حيوانية معدلة وراثيًا إلى وجود روابط سببية بين تآكل التيلومير والشيخوخة. [26] ومع ذلك ، فمن غير المعروف ما إذا كانت التيلوميرات القصيرة هي مجرد عرض من أعراض الشيخوخة أم أنها هي نفسها تساهم في تقدم عملية الشيخوخة. [27]

يلعب عمر الأب دورًا في طول تيلوميرات الطفل ، والتي لها آثار تطورية. على الرغم من أن تيلوميرات الكريات البيض تقصر مع تقدم العمر ، فإن تيلوميرات الحيوانات المنوية تطول مع تقدم العمر. يُفترض أن التيلوميرات الأقصر تفرض تكاليف طاقة أقل (بسبب قلة التكرار) ولكن لها أيضًا تكاليف مرتبطة بالجهاز المناعي وتكاليف أخرى مرتبطة بالشيخوخة والأمراض ، لذا فإن تأثير عمر الأب على طول التيلومير قد يكون تكيفًا لزيادة فرص ذلك سيكون الطفل لائقًا للبيئة التي ولد فيها. [28] [29]

التأثير المحتمل للضغوط النفسية

وجدت التحليلات التلوية أن زيادة الضغط النفسي المتصورة كانت مرتبطة بانخفاض طفيف في طول التيلومير - لكن هذه الارتباطات تضعف من عدم وجود ارتباط مهم عند حساب تحيز النشر. تهيمن الدراسات المقطعية والارتباطية على الأدبيات المتعلقة بالتيلوميرات كمؤشرات حيوية تكاملية للتعرض للإجهاد والشدائد ، مما يجعل التفسير السببي إشكاليًا. [25] [30] جادل استعراض عام 2020 أن العلاقة بين الإجهاد النفسي الاجتماعي وطول التيلومير تبدو أقوى بالنسبة للإجهاد الذي يحدث في الرحم أو في الحياة المبكرة. [31]

تمت ملاحظة ظاهرة الانقسام الخلوي المحدود لأول مرة بواسطة ليونارد هايفليك ، ويشار إليها الآن باسم حد هايفليك. [32] [33] تم فيما بعد اكتشافات مهمة من قبل مجموعة من العلماء نظمت في مؤسسة جيرون من قبل مؤسس جيرون مايكل دي وست ، والتي ربطت تقصير التيلومير بحد هايفليك. [34] مكّن استنساخ المكون الحفاز للإنزيم تيلوميراز التجارب من اختبار ما إذا كان التعبير عن التيلوميراز بمستويات كافية لمنع تقصير التيلومير قادرًا على تخليد الخلايا البشرية. تم عرض تيلوميراز في منشور عام 1998 في علم لتكون قادرة على إطالة عمر الخلية ، ومن المعروف الآن أنها قادرة على تخليد الخلايا الجسدية البشرية. [35]

أصبح من الواضح أن عكس تقصير التيلوميرات من خلال التنشيط المؤقت للإنزيم تيلوميراز قد يكون وسيلة فعالة لإبطاء الشيخوخة. السبب في أن هذا من شأنه إطالة عمر الإنسان هو أنه سيمد حد Hayflick. تم اقتراح ثلاث طرق لعكس تقصير التيلومير: الأدوية ، العلاج الجيني ، أو تثبيط التمثيل الغذائي ، ما يسمى السبات / السبات. حتى الآن لم يتم إثبات هذه الأفكار لدى البشر ، ولكن تم إثبات أن تقصير التيلومير ينعكس في حالة السبات ويبطئ الشيخوخة (Turbill، وآخرون. 2012 & amp 2013) وهذا السبات يطيل العمر الافتراضي (Lyman وآخرون. 1981). كما تم إثبات أن امتداد التيلومير قد عكس بنجاح بعض علامات الشيخوخة في فئران التجارب [36] [37] وأنواع الديدان الخيطية أنواع معينة انيقة. [38] تم افتراض أن التيلوميرات الأطول وخاصة تنشيط التيلوميراز قد يتسبب في زيادة السرطان (على سبيل المثال Weinstein and Ciszek، 2002 [39]). ومع ذلك ، فإن التيلوميرات الأطول قد تحمي أيضًا من السرطان ، لأن التيلوميرات القصيرة مرتبطة بالسرطان. كما تم اقتراح أن التيلوميرات الأطول قد تتسبب في زيادة استهلاك الطاقة. [21]

يمكن أن تكون تقنيات تمديد التيلوميرات مفيدة لهندسة الأنسجة ، لأنها قد تسمح بتربية خلايا الثدييات السليمة وغير السرطانية بكميات كبيرة بما يكفي لتكون مواد هندسية للإصلاحات الطبية الحيوية.

أثبتت دراستان على الطيور البحرية طويلة العمر أن دور التيلوميرات بعيد عن الفهم. في عام 2003 ، لاحظ العلماء أن تيلوميرات طائر النوء في ليتش (أوشيانودروما ليوكورهوا) يبدو أنه يطول مع العمر الزمني ، وهو أول مثال لوحظ لسلوك التيلوميرات هذا. [40] في عام 2006 ، جوولا وآخرون. [41] ذكرت أنه في نوع آخر من الطيور البحرية طويلة العمر غير ذات صلة ، وهي الفرقاطة العظيمة (فريجاتا طفيفة) ، انخفض طول التيلومير حتى ج على الأقل. يبلغ من العمر 40 عامًا (أي ربما على مدار العمر بأكمله) ، ولكن سرعة الانخفاض تباطأت بشكل كبير مع زيادة الأعمار ، وتفاوتت معدلات انخفاض طول التيلومير بشدة بين الطيور الفردية. وخلصوا إلى أنه في هذا النوع (وربما في الفرقاطة وأقاربهم بشكل عام) ، لا يمكن استخدام طول التيلومير لتحديد عمر الطائر بشكل كافٍ. وبالتالي ، يبدو أن هناك تباينًا أكبر بكثير في سلوك طول التيلومير مما كان يُعتقد في البداية.

علاوة على ذلك ، جوميز وآخرون. وجدت ، في دراسة لبيولوجيا المقارنة لتيلوميرات الثدييات ، أن طول التيلومير لأنواع مختلفة من الثدييات يرتبط عكسًا ، وليس بشكل مباشر ، مع العمر الافتراضي ، وخلصوا إلى أن مساهمة طول التيلومير في العمر لا تزال مثيرة للجدل. [42] هاريس وآخرون. وجدت أدلة قليلة على أن طول التيلومير في البشر هو مؤشر حيوي مهم للشيخوخة الطبيعية فيما يتعلق بالقدرات المعرفية والجسدية الهامة. [43] اختبر جيلي وبلاكبيرن ما إذا كان شيخوخة الخلايا في البراميسيوم ناتجًا عن تقصير التيلومير ، ووجدوا أن التيلوميرات لم يتم تقصيرها أثناء الشيخوخة. [44]

يتم سرد تسلسلات نيوكليوتيدات التيلومير المعروفة والمحدثة في موقع قاعدة بيانات Telomerase على الويب.

بعض سلاسل نيوكليوتيدات التيلومير المعروفة
مجموعة الكائن الحي تكرار التيلومير (5 'إلى 3' قرب النهاية)
الفقاريات الإنسان والفأر Xenopus TTAGGG
الفطريات الخيطية نيوروسبورا كراسا TTAGGG
قوالب الوحل فيساروم, ديديميوم TTAGGG
ديكتيوستيليوم AG (1-8)
البروتوزوا Kinetoplastid المثقبيات, كريثيديا TTAGGG
هدبيات البروتوزوا رباعية الغشاء, الزرق TTGGGG
باراميسيوم TTGGG (T / G)
Oxytricha, Stylonychia, إيبلوتس TTTTGGGG
البروتوزوا Apicomplexan المتصورة TTAGGG (T / C)
النباتات العليا نبات الأرابيدوبسيس thaliana TTTAGGG
سيستروم ايليجانس TTTTTTAGGG [45]
زهرة الآليوم CTCGGTTATGGG [46]
طحالب خضراء كلاميدوموناس TTTTAGGG
الحشرات بومبيكس موري TTAGG
الديدان الخراطيني الاسكاريس TTAGGC
خمائر الانشطار شيزوساكارومايس بومب TTAC (A) (C) G (1-8)
مهد الخمائر خميرة الخميرة TGTGGGTGTGGTG (من قالب RNA)
أو G (2-3) (TG) (1-6) T (الإجماع)
Saccharomyces castellii TCTGGGTG
المبيضات glabrata GGGGTCTGGTGCTG
المبيضات البيض جتجتاكجاتجتكتاكتكت
المبيضات الاستوائية GGTGTA [C / A] GGATGTCACGATCATT
المبيضات المالتوسا جتجتاكجاتجكاجاكتكجكت
المبيضات Guillermondii GGTGTAC
المبيضات الكاذبة GGTGTACGGATTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTGATTAGGTATGT

التيلوميرات ضرورية للحفاظ على سلامة الجينوم وقد تكون عوامل للأمراض المرتبطة بالعمر. [47] تظهر الدراسات المختبرية أن ضعف أو تقصير التيلومير يتم اكتسابه بشكل عام بسبب شيخوخة الخلايا وتطور الورم. [47] [48] يمكن أن تؤدي التيلوميرات القصيرة إلى عدم الاستقرار الجيني وفقدان الكروموسوم وتكوين انتقالات وتيلوميرات غير متبادلة في الخلايا السرطانية وتكون آفاتها الأولية أقصر بكثير من الأنسجة الطبيعية المحيطة. [49] [50]

لقد وجدت الدراسات القائمة على الملاحظة أن التيلوميرات القصيرة في العديد من أنواع السرطانات التجريبية. [51] بالإضافة إلى ذلك ، وجد أن الأشخاص المصابين بالسرطان يمتلكون تيلوميرات كريات الدم البيضاء أقصر من الأشخاص الأصحاء. [52] تشير التحليلات التلوية الحديثة إلى زيادة خطر الإصابة بالسرطان بمقدار 1.4 إلى 3.0 ضعف لمن لديهم أقصر تيلوميرات مقابل أطول تيلوميرات. [53] [54] ومع ذلك ، فإن الزيادة في المخاطر تختلف حسب العمر والجنس ونوع الورم والاختلافات في عوامل نمط الحياة. [51]

يتم استخدام العديد من التقنيات حاليًا لتقييم متوسط ​​طول التيلومير في الخلايا حقيقية النواة. إحدى الطرق هي اللطخة الجنوبية لجزء التقييد الطرفي (TRF). [55] [56] يتضمن اختبار PCR في الوقت الحقيقي لطول التيلومير تحديد نسبة التيلومير إلى نسخة واحدة من جين (T / S) ، والتي ثبت أنها متناسبة مع متوسط ​​طول التيلومير في الخلية. [57]

كما تم تطوير أدوات لتقدير طول التيلومير من تجارب تسلسل الجينوم الكامل (WGS). ومن بين هؤلاء TelSeq و [58] telomereCat [59] وصياد التيلومير. [60] تقدير الطول من WGS يعمل عادةً عن طريق التمييز بين قراءات تسلسل التيلومير ثم استنتاج طول التيلومير الذي أنتج هذا العدد من القراءات. وقد ثبت ارتباط هذه الطرق مع طرق التقدير الموجودة مسبقًا مثل PCR و TRF. يستخدم Flow-FISH لقياس طول التيلوميرات في خلايا الدم البيضاء البشرية. تم نشر طريقة شبه آلية لقياس متوسط ​​طول التيلوميرات باستخدام Flow FISH في Nature Protocols في عام 2006. [61]

في حين أن العديد من الشركات تقدم خدمات قياس طول التيلومير ، فقد تم التشكيك في فائدة هذه القياسات للاستخدام السريري أو الشخصي على نطاق واسع. [62] [63] روجت إليزابيث بلاكبيرن الحائزة على جائزة نوبل ، والتي شاركت في تأسيس شركة واحدة ، للفائدة السريرية لمقاييس طول التيلومير. [64]

تم إجراء معظم الأبحاث حول طول التيلومير وتنظيمه ، وعلاقته بالسرطان والشيخوخة ، على الثدييات ، وخاصة البشر ، التي لديها القليل من إنزيم التيلوميراز الجسدي أو معدوم. من المرجح بشكل ملحوظ أن يكون للخلايا الخارجية درجة حرارة متباينة في التعبير الجسدي للتيلوميراز أكثر من المواد المبطنة للحرارة. على سبيل المثال ، في العديد من الأسماك ، يحدث الإنزيم تيلوميراز في جميع أنحاء الجسم (ويرتبط بذلك ، يكون طول التيلومير متماثلًا تقريبًا في جميع أنسجته). تُظهر الدراسات التي أجريت على ectotherms والكائنات غير الثديية الأخرى أنه لا يوجد نموذج عالمي واحد لتآكل التيلومير بدلاً من ذلك ، فهناك تباين واسع في الديناميات ذات الصلة عبر Metazoa ، وحتى داخل المجموعات التصنيفية الأصغر ، تظهر هذه الأنماط متنوعة. نظرًا لاختلاف الجداول الزمنية للتكاثر لبعض الحرارة الخارجية ، فإن الاختيار على المرض مناسب لجزء أكبر بكثير من حياة هذه الكائنات مقارنة بالثدييات ، لذلك يبدو طول التيلومير في وقت مبكر ومتأخر من العمر ، وارتباطاتهم المحتملة بالسرطان ، بشكل خاص. مهم في هذه الأنواع من وجهة نظر نظرية تاريخ الحياة. [65]


الكائنات الحية الأعلى مثل البشر تتكون من خلايا ، من عدة مئات من الأنواع المتميزة إذا استبعدت جميع الأنواع البكتيرية التكافلية التي نحملها معنا. الغالبية العظمى من الخلايا لها فترات حياة قصيرة ومحدودة: فهي تتوقف عن التكاثر وتدمر نفسها أو تصبح شائخة بعد عدد من الانقسامات الإنجابية. قد تكون على دراية بحد Hayflick فيما يتعلق بهذا الموضوع: إنه عدد المرات التي تنقسم فيها الخلية قبل أن تزيل نفسها من دورة الخلية إلى مصير الدمار أو الشيخوخة. وبالمثل ، ربما سمعت عن التيلوميرات ، تسلسل الحمض النووي المتكرر في نهاية كروموسوماتنا. يتقلص طول التيلوميرات مع كل انقسام خلوي ، مكونًا نوعًا من ساعة العد التنازلي ، والتيلوميرات القصيرة جدًا هي إحدى الآليات التي يتم من خلالها إيقاف انقسام الخلية.

الواقع على الأرض أكثر تعقيدًا بكثير من هذه النظرة البسيطة للعد التنازلي لانقسام الخلية. بعض الخلايا لا تنقسم وتستمر معك مدى الحياة ، مثل العديد من تلك الموجودة في الجهاز العصبي المركزي. الخلايا الأخرى ، مثل تجمعات الخلايا الجذعية ، يتم تمديد التيلوميرات الخاصة بها بشكل متكرر بواسطة إنزيم التيلوميراز. تمتلك الخلايا المختلفة في أجزاء مختلفة من الجسم فترات حياة مختلفة تمامًا ، كما أن مجموعة العمليات المعقدة التي تحدد فترات الحياة هذه متغيرة للغاية وتتفاعل مع البيئة ومع بعضها البعض.

ومع ذلك ، ليس لأي من هذا تأثير مباشر كبير على العمر الافتراضي للكائن الحي. لا يمكنك فقط التلويح بعصا من شأنها إطالة عمر جميع الخلايا ، وتوقع رؤية امتداد مماثل للحياة في الكائن الحي - سواء حدث ذلك أم لا يعتمد على التفاصيل المعقدة لكيفية ارتباط الخلايا بالأعضاء والأنظمة. العمر الافتراضي للخلايا هو على طول الطريق هناك في أعماق الجهاز ، وتفاصيل داخلية إلى مكونات منخفضة المستوى منفصلة عن كيفية تصرف الجهاز بشكل إجمالي. لا يوجد سبب محدد لامتداد عمر الخلية ليكون له أي علاقة بالمدة التي يمكن أن يدومها الجهاز ككل. تم تصميم بعض أنسجتنا للتنقل بين جميع خلاياها واستبدالها بسرعة كبيرة ، في غضون أيام. لا يتم استبدال الخلايا الأخرى أبدًا وتعيش طويلًا كما نفعل نحن.

سلوك الخلية تابع لاحتياجات العضو أو النظام الذي هم جزء منه. تطورت الخلايا من نوع معين بحيث يكون لها سلوكها الحالي ومدى حياتها النموذجي لأنها ، عندما تعمل كنظام بالاقتران مع أنواع الخلايا الأخرى ، فإنها تنتج عضوًا عاملًا أو نظامًا يوفر بعض المزايا التطورية. إذا كان من الممكن القيام بذلك مع الكثير من دوران الخلايا وعمر الخلية القصير ، فسيكون كذلك. إذا كان من الممكن القيام بذلك مع القليل من دوران الخلايا وعمر الخلية الطويل ، فسيكون كذلك - ولكن يمكن أن ينتج أي من المسارين عضوًا وظيفيًا طويل العمر ويمكن الاعتماد عليه. هذه النقطة هي نقطة وصلت إليها مقالة حديثة في النهاية ، بعد جولة في حدود Hayflick وعلم الأحياء التيلومير:

صحيح أنه كلما تقدمنا ​​في السن تتقلص التيلوميرات ، ولكن فقط بالنسبة لخلايا معينة وخلال أوقات معينة فقط. الأهم من ذلك ، أن فئران المختبر الموثوقة لديها تيلوميرات أطول بخمس مرات من حياتنا ، لكن حياتها أقصر بـ 40 مرة. هذا هو السبب في أن العلاقة بين طول التيلومير والعمر غير واضحة.

يبدو أن استخدام حد Hayflick وطول التيلومير للحكم على أقصى عمر للإنسان يشبه فهم زوال الإمبراطورية الرومانية من خلال دراسة الخصائص المادية للكولوسيوم. روما لم تسقط لأن الكولوسيوم تدهور الكولوسيوم بسبب سقوط الإمبراطورية الرومانية.

داخل جسم الإنسان ، لا تتطور معظم الخلايا ببساطة. يتم إصلاحها وتنظيفها أو استبدالها بالخلايا الجذعية. تتدهور بشرتك مع تقدمك في العمر لأن جسمك لا يستطيع أداء وظائفه الطبيعية للإصلاح والتجديد.

تحدث العمليات التي تسبب الشيخوخة التنكسية على مستوى الخلايا وآليات البروتين المحددة داخل الخلايا ، مما يضر بقدرتها على الأداء كما ينبغي. تنتج الخلايا القديمة التالفة خلايا أكثر تقدمًا وتلفًا عند انقسامها. الخلايا الجذعية القديمة التالفة تفشل ببساطة في مواكبة مهامها المتمثلة في صيانة الأنسجة. تصبح الخلايا طويلة العمر تدريجيًا أكثر تضررًا وعجزًا ، أو تموت ، وكلاهما يسبب مشاكل واضحة جدًا عندما يحدث في الجهاز العصبي والدماغ.

الشيخوخة هي ببساطة مسألة ضرر. لكن كيفية ترجمة هذا الضرر إلى فشل في النظام ليست مسألة مباشرة تتعلق بخلايا تعيش لفترة أطول أو تموت الخلايا في وقت أقرب - إلا عندما يحدث ذلك لبعض أنواع الخلايا طويلة العمر. يفشل كل نسيج في نفس العمليات العامة ، ولكن هذه العمليات تنتج مجموعة واسعة جدًا من أنماط الفشل ، اعتمادًا على طبيعة الأنسجة والخلايا التي تتكون منها. تجاوز البساطة المقارنة للأسباب الجذرية للشيخوخة ، وسيصبح كل شيء أكثر تعقيدًا بشكل تدريجي مع تقدمك نحو وصف البيولوجيا شديدة التنوع للأمراض القاتلة المرتبطة بالعمر. هذا هو السبب في أن التدخل في الأسباب الجذرية هو أفضل استراتيجية على الإطلاق وأكثرها فعالية من حيث التكلفة ، والاستراتيجية الوحيدة التي من المحتمل أن تحقق تقدمًا ذا مغزى نحو تجديد شباب الإنسان في حياتنا.

كملاحظة أخيرة ، بالنسبة لأموالي ، أراهن على أن أشكال الداء النشواني هي الحالة الخارجية الحالية التي تحد من مدى حياة الإنسان. تشير الأدلة إلى أن هذا هو ما يقتل في نهاية المطاف كبار السن ، الأفراد المرنين الذين تجاوزوا سن 110 ، وتجنبوا أو نجوا من جميع الحالات الطبية المميتة المرتبطة بالعمر التي ادعت أقرانهم.

أنا أحب قراءة هذه المقالات هنا. أحاول أن أقرأ كل واحد. ومع ذلك ، أتمنى أن يتفق جميع رجال العلم مع بعضهم البعض في كثير من الأحيان. أنت تقول إن تآكل التيلومير لا علاقة له بالشيخوخة. هذا الرجل يقول أن كل شيء له علاقة به. أوه ، أتمنى لو كنت قد قضيت وقتًا أطول في دراسة علم الأحياء. هيه هيه. هذا مأخوذ من المقال: "بعبارة أخرى ، الخلل في وظيفة التيلومير ليس مجرد متسبب واحد في تدهور الصحة في سن متقدمة. إنه العنصر الرئيسي ، وفقًا لديبينيو وزملائه."

Nathan Voodoo: أعتقد أن طول التيلومير هو سمة ثانوية للشيخوخة. يختلف الآخرون. من الممكن أيضًا أن تكون التيلوميرات الأقصر تأثيرًا ثانويًا للأسباب الأولية الفعلية للشيخوخة ، ومن ثم تستمر في التسبب في مجموعة من المشكلات الثالثة - لذا فإن إبقائها لفترة طويلة قد يوقف مشكلات المرحلة الثالثة بينما لا تفعل الكثير لمسار الشيخوخة بشكل عام.

لا يزال كل شيء مفتوحًا لتصميم صارم بطريقة أو بأخرى.

هناك دراسات على الفئران تعمل فيها التيلوميراز المعزز (وبالتالي التيلوميرات الأطول) على إطالة العمر ، ولكن ليس من المسلم به أن السبب وراء إطالة العمر هو إطالة التيلوميرات. يقوم التيلوميراز بمجموعة من الأشياء الأخرى أيضًا.

قد تضع في اعتبارك أن العديد من شركات قياس طول التيلومير تحصل على تمويل استثماري الآن ، أو حصلت عليه مؤخرًا ، وهذا سيكون له تأثير على ما تقوله الصحافة. فكر في ما كانت تقوله الصحافة حول ريسفيراترول وسيرتوينز عندما كان هناك الكثير من التمويل الاستثماري لهذا البحث - بشكل عام سترى المزيد من المقالات التي تبالغ في أهمية الآليات والعلوم المشاركة في عمل الشركات الممولة من المشروع. . هذه هي الطريقة التي يعمل بها العالم.

تتحدث معظم المقالات الشائعة وتقريباً كل ورقة عن طول التيلومير المطلق ، وليس المعامل الأكثر أهمية على الأرجح - معدل التآكل ، المعروف أيضًا باسم TROC ، معدل تغير التيلومير. انظر على سبيل المثال:

شكرا للإستجابة. سوف أنظر في هذه الأشياء التي ذكرتها.


خيارات الوصول

احصل على حق الوصول الكامل إلى دفتر اليومية لمدة عام واحد

جميع الأسعار أسعار صافي.
سيتم إضافة ضريبة القيمة المضافة في وقت لاحق عند الخروج.
سيتم الانتهاء من حساب الضريبة أثناء الخروج.

احصل على وصول محدود أو كامل للمقالات على ReadCube.

جميع الأسعار أسعار صافي.


U S C M A & # 8211 الولايات المتحدة الأمريكية الجمعية الطبية الكولومبية

هل طورت البيولوجيا طريقة لحماية النسل من ويلات الشيخوخة من خلال خلق حاجز مادي يفصل بين الوالدين وصغارهم؟

لقد كانت فكرة أن كل كائن حي يجب أن يشيخ مفهومًا فاجأ العديد من علماء الأحياء. لفترة طويلة ، كان يُعتقد أن الشيخوخة هي عملية تحدث فقط في الكائنات متعددة الخلايا. والسبب في هذا الافتراض الغريب هو أننا عرفنا أن الخلايا الجسدية - مثل تلك التي تتكون منها الكلى والدماغ والكبد - فقدت وظائفها بمرور الوقت: فقد تقدمت في العمر. علاوة على ذلك ، انقسمت تلك الخلايا عددًا محدودًا من المرات ، حوالي 50 مرة ، وصلت بعدها إلى ما يسمى بحد Hayflick ، ​​وتوقفت عن التكاثر ، وماتت.

كان يُعتقد أن الكائنات أحادية الخلية قادرة على الانقسام إلى الأبد ، طالما سمحت الظروف: جيل واحد ينجب الجيل التالي عبر الزمن - نوع من الخلود. إذا كانت الكائنات وحيدة الخلية مثل الخلايا الجسدية ، فإنها سوف تتقدم في العمر عندما تنقسم ، وتصل إلى حد Hayflick ، ​​وتموت.

لم يكن حتى الخمسينيات من القرن الماضي عندما بدأ الباحثون الذين فكروا في الشيخوخة في تغيير رأيهم. أصبح من الواضح أن الخلايا الوليدة لبعض الكائنات وحيدة الخلية بدت وكأنها تتجدد ، لتبدأ من الصفر ، بينما تراكمت الخلايا الأم الانحرافات الخلوية التي تشير إلى الشيخوخة. شوهد هذا النمط من الشيخوخة في الكائنات الحية البعيدة تطوريًا مثل Saccharomyces cerevisiae ، والمعروفة باسم خميرة البراعم أو الخباز ، والبكتيريا مثل Caulobacter crescentus و Escherichia coli. 1–3 الشيخوخة ، على ما يبدو ، هي ملكية عالمية لجميع الكائنات الحية.

بالنسبة لي ، طرح هذا الإدراك سؤالًا أكثر جوهرية ، سؤالًا ، كعلماء أحياء ، نادرًا ما يُسمح لنا بالتفكير فيه: لماذا تسمح الخلايا بتراكم بعض الأخطاء؟ If evolution is such a powerful process—one that finds solutions to all manner of problems—how could there be processes or problems that can’t be fixed?


Telomeres - Biological Clock

In principal, bacteria can live forever. If a bacterial cell is housed in good conditions it will continue to divide and increase in size indefinitely. Cells of higher organisms like birds or mammals work slightly differently. Until the middle of the 20th century, it was believed that cells in all species could also live forever. However, in 1912, a scientist at the Rockefeller Institute named Alexis Carrel performed a study designed to study the length of time a chicken fibroblast would divide for. Fibroblasts are the connective tissues cells that increase the strength of the three dimensional framework that is the main support of other cells. Carrel fed the cells a broth that was made from chicken embryos, feeding them on a regular basis. Excess cells were discarded on a periodic basis. The fibroblasts continued to divide for years without any sign of slowing until 30 years later when the experiment was ended (after Carrel's death). It showed that in a specially controlled environment the cells of higher organisms can also be immortal.

It took until the 1960's for a study that conflicted with Carrels results to be done. Leonard Hayflick's study of human fibroblasts, maintained in a similar set of conditions to those of Carrel, would only divide about 50 times and then cease. Which one had the more valid methods? It seems that it was Carrel's experiment was the flawed one. Because the nourishing broth that he used to feed the cells had a low level content of chicken fibroblasts he was inadvertently adding new cells on a regular basis. This problem was resolved by Hayflick who showed that there was a maximal number of divisions that a cell could make in controlled conditions this came to be known as the Hayflick limit.

The Hayflick limit can be considered a genetic program that limits the number of times a cell can divide. The reason for this limitation is that it reduces the likelihood of uncontrolled cell growth that can result in cancer. Several studies have shown that in cancer cells the genetic clock doesn't have a time limit thus allowing the cells to divide indefinitely.

Over time, the reason for the Hayflick limit was discovered. Chromosomes in higher organisms are capped with telomeres which are a special kind of DNA structure. The primary purpose of the telomeres is to prevent the ends of the chromosomes from degenerating. The process of DNA replication is what happens when the chromosomes are duplicated through cell division. Due to the way this process works, the tips of the telomeres cannot be effectively replicated. This means that the telomeres grow progressively shorter after each time the cell divides. It seems that once the cells telomeres have reached a certain length the cell ceases to be able to divide. (This isn't the case in bacteria because they have circular cells that do not include telomeres). After approximately 50 divisions, the fibroblasts not only cease to be able to divide by them also take on a different "look" and behavior. The metabolic rates of the fibroblasts slow down they grow in size and also accumulate lipofuscin which is the pigment that causes age spots. This is known as cellular senescence.

Could aging be explained as what happens once cells have reached the Hayflick limit and are no longer able to divide? There is no conclusive answer to that question at this time. It seems that in certain tissues, including the skin and the lining of blood vessels the Hayflick limit may be a key to the aging process. An example is the increased advancement of vascular diseases with age that might be in part caused by the decreased ability of vascular epithelial cells to divide. The Hayflick limit may also be a factor in age related changes to the skin as an increased number of dermal fibroblasts attain the state of senescence. Yet interestingly, the brain cells as well as cells in the nerves, muscles and retina do not normally divide, which means that they would not reach the Hayflick limit.

The Hayflick limit does not apply to all cells. Germ cells (the cells that turn into ova or sperm) and cancer are obviously immortal. Embryonic stem cells (and possibly some adult stem cells) also have the potential to be long lived or even immortal. When a store of immortal stem cells is present in certain tissues (such as skin) the buildup of dysfunctional cells that reaches the Hayflick limit seems to be a problem. The majority of cells do not die when they reach the Hayflick limit rather they enlarge and lose the majority of their practical functions. They also slow, and can cause problems with younger cells. It has been observed that the skin of older people has three times as many senescent fibroblasts then that of younger people. The accumulation of senescence and its resulting loss of capacity can have an effect on a number of different tissues.

There is a way to override the Hayflick limit. Certain mutations in cancer cells do indeed override the Hayflick limit. There are also certain viruses that have a similar effect. These viruses include the papilloma virus that immortalizes the cells that it infects. A cellular mechanism that overrides the Hayflick limit has been discovered. There is a particular gene that encodes an enzyme (telomerase) which has the ability to restore shortened telomere. The cells in which telomerase has had an effect appear to be immortal. Most normal cells have a more suppressed telomerase activity which keeps them from dividing beyond a certain limit. Scientists have discovered that in embryonic stem cells the Nanog gene is activated thus making them immortal. INKa is another gene that is an active part of senescence. INKa's role is to encode the P16 protein which helps to prevent cancer by inducing cellular senescence. Mice that have P16 were proven to have less senescent cells then there are in regular mice. The tissues of these mice have more regenerative capacity with age. At the same time the mice with less P16 had a reduced lifespan due to a higher rate of cancer.

The Hayflick limit has an effect on age related changes and certain tissue based diseases (primarily based in the blood and skin). Eradicating the Hayflick limit would cause increase the possibility of cancer. It also seems that the number of times a cell dives before it hits the limit is not prescribed. Various environmental factors can accelerate or retard the cellular clock. Raised levels of free radical formation have been proved to shorten the Hayflick limit. Other substances have been shown to extend the limit in certain types.

How can the effect of the cellular clock be minimized when it comes to the aging process? Research is beginning to show that we will be able to use genetic engineering to alter the system that produces the Hayflick limit. This is still in the experimental stages and the problem with it at the moment is that it seems that the side effects would be an increased possibility of cancer. Scientists are also looking into a way to remove senescent cells from the tissues without causing any residual damage. At the moment all that we can do is avoid unnecessary cell division. Avoiding these cell divisions can be done by lowering exposure to the factors that cause it. All kinds of cellular stress and tissue damage can result in cell division. This is particularly true of free radicals, inflammation, mutagens, certain toxins and UV radiation all of which have been proved to raise levels of cell division. Antioxidants appear to have the opposite effect. Garlic extract might be a regular everyday substance that can limit the Hayflick limit to a small extent. More clinical studies are required to prove its practical effects.


محتويات

Belief of cell immortality

Prior to Hayflick's discovery, it was believed that vertebrate cells had an unlimited potential to replicate. Alexis Carrel, a Nobel prize-winning surgeon, had stated "that all cells explanted in culture are immortal, and that the lack of continuous cell replication was due to ignorance on how best to cultivate the cells". He supported this hypothesis by having cultivated fibroblasts from chick hearts, and to have kept the culture growing for 34 years. [ 3 ] This indicated that cells of vertebrates could continue to divide indefinitely in a culture. However, other scientists were unable to reproduce Carrel's result.

In fact, Carrel's result was due to an error in his experimental procedure: chick embryonic stem cells were added to the culture daily. This allowed for the cultivation of new fresh cells in the culture, and not simply the infinite reproduction of the original cells present in the culture. [ 1 ] It has been speculated that Carrel knew about the error, but he never admitted it. [ 4 ] [ 5 ]

Experiment and discovery

Dr. Leonard Hayflick first became suspicious of Carrel’s theory while working in a lab at the Wistar Institute. Hayflick was preparing normal human cells to be exposed to extracts of cancer cells when he noticed the normal cells had stopped proliferating. At first he thought that he had made a technical error in preparing the experiment, but later he began to think that the cell division processes had a counting mechanism. Working with Paul Morehead, he designed an experiment that showed the truth about normal cell division.

The experiment proceeded as follows. Hayflick and Morehead mixed equal numbers of normal human male fibroblasts that had divided many times (cells at the 40th population doubling) with female fibroblasts that had divided only a few times (cells at the 10th population doubling). Unmixed cell populations were kept as controls. When the male ‘control’ culture stopped dividing, the mixed culture was examined and only female cells were found. This showed that the old cells ‘remembered’ they were old, even when surrounded by young cells, and that technical errors or contaminating viruses were unlikely explanations as to why only the male cell component had died. [ 1 ] [ 6 ] The cells had stopped dividing and become senescent based purely upon how many times the cell had divided.

These results disproved the immortality theory of Carrel and established the Hayflick Limit as accredited biological theory which, unlike the experiment of Carrel, has been reproduced by other scientists.


The Hayflick limit has been found to correlate with the length of the telomeric region at the end of chromosomes. During the process of DNA replication of a chromosome, small segments of DNA within each telomere are unable to be copied and are lost. ⎖] This occurs due to the uneven nature of DNA replication, where leading and lagging strands are not replicated symmetrically. ⎗] The telomeric region of DNA does not code for any protein it is simply a repeated code on the end region of linear eukaryotic chromosomes. After many divisions, the telomeres reach a critical length and the cell becomes senescent. It is at this point that a cell has reached its Hayflick limit. ⎘] ⎙]

Hayflick was the first to report that only cancer cells are immortal. This could not have been demonstrated until he had demonstrated that normal cells are mortal. Α] Β] Cellular senescence does not occur in most cancer cells due to expression of an enzyme called telomerase. This enzyme extends telomeres, preventing the telomeres of cancer cells from shortening and giving them infinite replicative potential. ⎚] A proposed treatment for cancer is the usage of telomerase inhibitors that would prevent the restoration of the telomere, allowing the cell to die like other body cells. & # 9115 & # 93


CINEMA SCIENCE: The Dangerous Biology of Annihilation: A thought-provoking, high-concept sci-fi thriller, Alex Garlands film touches on real-world phenomena such as Hox genes, the Hayflick limit and the Mandelbrot set. While its science is complex and its subject matter can be intense, the film provides many excellent opportunities for discussions about biology in senior secondary classrooms, as DAVE CREWE describes.

Typically, the films selected for Cinema Science are relatively mainstream--movies you can expect the average high school student to have heard of, if not seen. Annihilation (2018) is different. Despite its formidable pedigree (written and directed by Alex Garland, starring the likes of Natalie Portman, Jennifer Jason Leigh and Tessa Thompson), this sci-fi film proved too cerebral for Paramount, which infamously dumped the end product onto Netflix. Consequently, Annihilation only received a theatrical release in North America and China (1)--hardly the typical trajectory of a mainstream movie.

But Annihilation boasts something not necessarily shared by its blockbuster competitors: accessibility. Some 38 per cent--and rising--of the Australian population have access to Netflix, (2) so many of your students will be able to watch Annihilation. even if they haven't yet. Annihilation also possesses a robust scientific spine adapted from Jeff VanderMeer's eponymous 2014 novel and inspired by thoughtful sci-fi forebears like Stalker (Andrei Tarkovsky, 1979), (3) 2001: A Space Odyssey (Stanley Kubrick, 1968) (4) and The Thing (John Carpenter, 1982), (5) Garland's film slithers through cellular biology, optical phenomena and our genetic code on its way to a decidedly ambiguous conclusion.

Annihilation is best suited to senior secondary Science classrooms, both for the complexity of its scientific subject matter and for the graphic nature of its content: the film features some gory and legitimately horrific scenes.

Annihilation's protagonist, Lena (Portman), is a professor at Johns Hopkins University researching 'the genetically programmed life cycle of a cell'. (6) That research isn't what leads her into the 'Shimmer'--an iridescent, extraterrestrial area. She's there searching for clues to save her husband, Kane (Oscar Isaac), a soldier who's the first to safely return from within the Shimmer but is shortly thereafter afflicted with an unexplained ailment. But Lena's knowledge of cells proves crucial to understanding the nature of what's occurring within the Shimmer, just as cellular biology reveals itself as the thematic and narrative foundation of the film.

That's reflected in something as simple as the short scene showing Lena teaching a class. 'All cells were ultimately born from one cell,' she tells her students.

A single organism, alone on planet Earth, perhaps alone in the universe. About 4 billion years ago, one became two. Two became four. Then eight, sixteen, thirty-two. The rhythm of the dividing pair, which becomes the structure of every microbe, blade of grass, sea creature, land creature and human. The structure of everything that lives. and everything that dies.

This scene could be used as stimulus for a lesson on cellular division - not just in a Biology or a Mathematics classroom, where you might model the exponential growth of a dividing cell.

As teachers, we become proficient at spinning simple stimuli like this scene into an extended exploration of a topic within the curriculum, allowing the germ of an idea to - much like a dividing cell - multiply into bigger and more sophisticated concepts. Annihilation's interest in the cell and its reproductive process extends beyond this short scene. Within the Shimmer, on more than one occasion Lena observes an apparently normal cell split into a second one: a cell pulsing with colour, its rainbow cilia flailing. At the film's climax, Lena encounters the 'Entity': an enigmatic organism that mimics her movements. We watch it form from a single cell dividing, growing and, ultimately, mirroring its progenitor. At its thematic core, the film features the key processes of reproduction: doubling, mirroring, mutation.

Annihilation is a perfect starting point to explore how intimately mutation is intertwined with such reproductive processes. The film is filled with extraordinary, inexplicable mutations. Some of these are beautiful, as when a single plant sprouts into a bounty of colourful flowers, or different species grow from the same root. Lena stumbles upon an elk with flowers sprouting from its antlers and then watches as - almost imperceptibly--it splits into a second elk. (7) More often, the mutations are horrific: An albino crocodile's maw filled with shark's teeth. Human intestines contorting into writhing eels. A terrifying bear-like creature mimicking the screams of its human victims.

These mutations aren't realistic, necessarily they represent the power of the Shimmer - and its threat. As a jumping-off point, though, these transformations allow for discussion around the intersection of cellular division, mutation and evolution. Without the imperfections in this process, we would've never progressed beyond simple organisms. The alacrity of the mutations within the Shimmer, then, suggests the magnitude of the threat offered to our species, even as Garland keeps his cards close to his chest regarding the Shimmer's nefarious intentions--or lack thereof. (8)

One of the film's most enduring images is a family of trees awkwardly arched into human poses, branches grasping like arms - skeletons that never were bodies, solid shadows of humanity. One of the scientists accompanying Lena into the Shimmer, Josie (Thompson), offers a hypothesis: 'Do you know what you'd get if you sequenced [that leaf]? [. ] Human Hox genes.' Lena explains that Hox genes 'define the body plan, the physical structure'.

That isn't quite how human Hox genes work you wouldn't expect a tree to grow into a person thanks to a bit of gene splicing. But it resembles reality closely enough to prompt classroom discussions and/or investigations. As Dr Adam Rutherford--scientific adviser on Annihilation (as well as on Garland's previous film, 2014's Ex Machina) - puts it, Hox genes 'lay out the polarity of the organism': 'When [Josie] is talking about them, she's trying to rationalize how you could be seeing plants growing in human form, because that runs counter to our own scientific understanding of the gene.' (9) There's more than enough material here to allow for a research project wherein students explore the properties of Hox genes and how they're represented in Annihilation.

Another question worth investigating: could we make cells immortal? No, I'm not engaging in idle conjecture this is a question posed within the film itself. In a pre-Shimmer flashback, Lena explains the notion to her husband: 'You take a cell, circumvent the Hayflick limit, you can prevent senescence [. ] It means the cell doesn't grow old it becomes immortal.' Sure sounds like science fiction, but this isn't entirely outside the realm of possibility.

The Hayflick limit Lena is referring to describes cells' inability to divide forever. Each time a cell undergoes mitosis, its telomeres--genetic sequences found at the ends of chromosomes --degrade until, eventually, the consistency of the chromosome deteriorates beyond the point where reproduction can continue. Ageing, dying: senescence. But not all cells are subject to this phenomenon. In fact, the cell division Lena shows her class is that of a HeLa cell, (10) an 'immortal' cell discovered in 1951 and subsequently widely used in scientific research due to its resistance to senescence.

* Lobsters are sometimes described as 'immortal' as their cells don't experience senescence. Evaluate this claim.

* How do Hox genes work? Is their representation in Annihilation scientifically accurate?

* What are the different types of cellular division?

CANCER AND SELF-DESTRUCTION

Alex Garland has said that he starts his films with a central idea. For Annihilation, it was self-destruction, so it's no coincidence that Lena has the profession she does and works with cancer cells.

The HeLa cell isn't just any cell. It stems from a sample of cervical cancer cells taken from Henrietta Lacks, after whom the cells were named. And, while it's interesting to explore the ramifications of immortal cells both inside and outside the context of Annihilation, the HeLa cell mostly closely resonates with Garland's intentions because of its cancerous origins.

Fundamentally, Annihilation is a film about cancer. It's a film about unbridled growth and mutation, a film about how something as apparently innocent as cellular division can manifest itself as something terrifying, something fatal. The screenplay is dotted with explicit references to cancer in humans: Cass (Tuva Novotny) lost her daughter to the disease, while Dr Ventress (Leigh) has herself been diagnosed with terminal cancer. I regard these as Garland's signposts, providing his audience with a framework to make sense of an often-confusing narrative.

To understand these signposts, one needs to understand the properties of cancer itself. As explained by the Australian Cancer Council, cancer is a disease of the body's cells. Normally cells grow and multiply in a controlled way, however, if something causes a mistake to occur in the cells' genetic blueprints, this control can be lost. Cancer is the term used to describe collections of these cells, growing and potentially spreading within the body. (12)

Essentially, cancer is a genetic error - much like the mutations that drive evolution - that turns our cells' multiplicative tendency against us. In other words: self-destruction.

The antagonist of Annihilation--the Entity, the Shimmer, whatever you want to call it--embodies these mechanics. The influence of the Shimmer is mutative, twisting and warping genetic code. But the Entity itself, which mirrors Lena's and Kane's movements and assumes their forms, strikes me as cancerous on a global scale. While the Entity's intentions remain unclear, the conclusion of the film, with Entity-Kane and Lena (perhaps herself an offshoot of the Entity) tentatively reunited, suggests that it exists to reproduce and consume Earth organisms--including, naturally, humanity.

Cancer is a fascinating subject for any Biology classroom. To examine cancer is to understand the incredible potential of our biological processes and the multivalent possibilities of mutation, but also to recognise the threat of unbridled reproduction. Understanding cancer is more than academic, of course. The better we understand a disease, the better we can fight it. Recognising that cancer is, fundamentally, our own cells turned against us will allow students to comprehend the need for debilitating treatments like radiation therapy, whereby we poison our cells in order to fight the cancer.

'The cure for cancer' remains science's holy grail, so why not spend a lesson--or an entire assessment task - with your class exploring scientists' attempts to refine cancer treatments. Just recently, for instance, a woman was cured of advanced breast cancer through a trial that used gene therapy to, in essence, rewrite her immune system to target the cancer cells specifically. As reported by New Scientist, 'It's the first time this type of therapy has worked in breast cancer, suggesting that it may be able to help many more people with common types of cancer'. (13) Understanding this therapy requires a sophisticated grasp of genetics, the human immune system and cancer--an excellent opportunity for a senior secondary Biology activity.

* What kinds of methods are currently used to treat cancer? What are the limitations and side effects of these treatments?

* How is cancer an example of 'self-destruction'?

For me, the most enduring image of Annihilation isn't the iridescent sheen of the Shimmer, nor the corrupted bear-creature that stalks our heroines. Rather, I remember the simple, repeated shot of a hand (or hands) through a glass of water, reflected by the bending of the light. This mundane inversion characterises the sensation of watching Annihilation, seeing the ordinary flipped into something ambiguously sinister.

There's nothing miraculous about these images. They're a simple example of how refraction can cause reflection, as the light bends while travelling through the glass and the water within. It's trivially easy to replicate this phenomenon with your class all you need is a glass of water and a piece of paper. (14) Draw an arrow - or any shape for which the reflection will be obvious--and observe it through the water. From the right vantage point, the image will be reflected horizontally. But ask your students to adjust the position of the paper, the glass and/or themselves, and they should find that it isn't always reflected.

This simple experiment is an engaging introduction to a Physics unit on optics - specifically, refraction. Investigating this phenomenon requires an understanding of refractive index, focal points and other key features of optics. Linking back to Annihilation, you could tie these principles into the multicoloured appearance of the Shimmer: we observe similarly colourful displays in, say, soap bubbles. The applications for these phenomena are manifold for instance, without the principles of refraction, we wouldn't have access to the optical-fibre technology that powers the fast internet that allows you to stream Annihilation in HD--well, depending on your provider. (Rather cleverly, Garland and director of photography Rob Hardy incorporate refractive phenomena into the very look of the film. For example, they're not shy about keeping lens flares in their shots--flares caused by the refraction of bright light.)

Refraction is referenced in Annihilation outside of these moments. It's offered as an explanation for why the squad can't communicate outside the Shimmer with their radios. As Josie explains, 'The light waves aren't blocked they're refracted, and. it's the same with the radios. Signals aren't gone. They're scrambled.' She extrapolates this observation to apply to the fantastic mutations seen within the Shimmer: 'The Shimmer is a prism, but it refracts everything. Not just light and radio waves. Animal DNA. Plant DNA. All DNA.'

We're venturing further into science fiction than accepted science here - and it's worth clarifying that Josie's explanation is a hypothesis that remains unproven within the diegesis--but the notion of refracted matter is far from fiction. At the core of quantum mechanics is wave--particle duality: simply put, every piece of matter is at once a particle and a wave. By definition, waves are subject to refraction, so every piece of matter can, in fact, be refracted. Exploring the associated physics of this is perhaps beyond the scope of a typical high school classroom, but it could be a worthy extension activity for interested pupils.

* How does refraction explain a glass of water reflecting the image behind it?

* Investigate how fibre optics uses refractive properties to transmit information.

A common misconception about Mathematics is that it is dry and deterministic, lacking beauty and artistry. There are few better ways to dispute this viewpoint than the Mandelbrot set: a beautiful, fractal picture of infinite possibilities. This set is, in fact, what the Entity's appearance was modelled after per Rutherford, 'The Mandelblob is an animated 3D manifestation of the Mandelbrot set. That's what the alien is when you see it.' (15)

For junior secondary Mathematics students, this represents a prime opportunity to simply show off the wonder of the Mandelbrot set and, perhaps, associated Julia sets. More advanced mathematicians might wish to explore the underlying mathematics of the Mandelbrot set: how it is generated through iterative series on the complex plane, and even its unexpected ties to chaos mathematics.

You would expect your students to be familiar with the term 'annihilation' as a synonym for 'destruction'. But, as part of the right Physics topic, you could hook into the scientific definition of the term: the collision of a particle and its antiparticle. What are antiparticles? Ah, well, that's a whole 'nother discussion.

If you're really feeling like a deep dive into the foundations of science, Annihilation provides an opportunity to examine the core of scientific discovery. The Hollywood Reporter's Ciara Wardlow argues that Annihilation 'presents one of the best meditations I have ever seen on the metaphysics of scientific inquiry--about the fundamental nature of science that, ironically, cannot in itself be investigated through the scientific method'. Examining what Wardlow is talking about--that 'at the heart of good science is a vein of self-destruction', that our perception of science is torn between 'fascination and repulsion' (16)--necessitates the kind of deep consideration of science that's simultaneously challenging and intensely rewarding.

(1) David Sims, 'The Problem with Annihilation's Messy Release', The Atlantic, 31 January 2018, <https://www.theatlantic.com/entertamment/archive/2018/01/annihilation-paramount-netflix/551810/>, accessed 27 June 2018.

(2) 'Netflix Hits New High in Australia--7.6 Million', media release, Roy Morgan, 28 September 2017, <http://www.roymorgan.com/findings/7343-netflix-subscriptions-june-2017-201709270713>, accessed 27 June 2018.

(3) Jordan Raup, 'Go Behind-the-scenes of Alex Garland's Stalker-inspired Sci-fi Drama Annihilation, The Film Stage, 7 July 2016, <https://thefilmstage.com/news/go-behind-the-scenes-of-alex-garlands-stalker-inspired-sci-fi-drama-annihilation/>, accessed 29 June 2018.

(4) Gav Murphy, 'Alex Garland's 4 Biggest Sci-fi Influences', IGN, 13 December 2017, <http://au.ign.com/articles/2017/12/13/alex-garlands-4-biggest-sci-fi-influences>, accessed 29 June 2018.

(5) Peter Debruge, 'Film Review: Annihilation', Variety, 21 February 2018, <https://variety.com/2018/f1lm/reviews/annihilation-review-natalie-portman-1202706321/>, accessed 29 June 2018.

(6) Dialogue from the film, as spoken by Dr Ventress.

(7) A real 'blink-and-you'll-miss-it' moment. It wasn't until my third time through the film that I realised the second elk wasn't simply behind the first.

(8) There are more than a few ways to interpret the film's ending, which is clearly intended to deliver more questions than answers. Whatever the Shimmer 'wants', it's not necessarily malicious. As Lena puts it in her debrief, 'It wasn't destroying. It was changing everything. It was making something new.'


شاهد الفيديو: الصف الثالث الوحده الثانيه.الدرس1ما حاجات الكائن الحي (شهر فبراير 2023).